Stem-loop sequence ssc-mir-216-2

AccessionMI0022141 (change log)
DescriptionSus scrofa miR-216-2 stem-loop
Gene family MIPF0000054; mir-216
Literature search

4 open access papers mention ssc-mir-216-2
(6 sentences)

Stem-loop
   --ugag     u         cu   a      --a   -  u 
5'       uuggc uaaucucag  ggc acugug   gau gu c
         ||||| |||||||||  ||| ||||||   ||| ||  
3'       aaucg auuaggguc  cug ugacac   cua ca a
   gagaca     u         -u   g      ccc   a  u 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-216

Accession MIMAT0002130
Sequence

11 - 

uaaucucagcuggcaacugugag

 - 33

Get sequence
Deep sequencing28 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).