Stem-loop sequence ssc-mir-196a-1

AccessionMI0022138 (change log)
DescriptionSus scrofa miR-196a-1 stem-loop
Gene family MIPF0000031; mir-196
Literature search

16 open access papers mention ssc-mir-196a-1
(103 sentences)

Stem-loop
   -   -a    a ua   a    c         - gc u  a 
5'  cug  guga u  ggu guuu auguuguug g  c gg u
    |||  |||| |  ||| |||| ||||||||| |  | ||  
3'  gac  cacu a  cca caaa uacagcaac c  g uc u
   u   gg    c gc   c    u         a aa -  u 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 24836774-24836853 [+]
sense
ENSSSCT00000021429 ; ssc-mir-196a-1.1-201; exon 1
Database links

Mature sequence ssc-miR-196a

Accession MIMAT0002163
Previous IDsssc-miR-196
Sequence

11 - 

uagguaguuucauguuguuggg

 - 32

Get sequence
Deep sequencing15 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).