Stem-loop sequence ssc-mir-194a

AccessionMI0022137 (change log)
DescriptionSus scrofa miR-194a stem-loop
Gene family MIPF0000055; mir-194
Literature search

11 open access papers mention ssc-mir-194a
(30 sentences)

Stem-loop
   ug       cu         a      g     g  c 
5'   ccacccc  guaacagca cuccau uggaa ug c
     |||||||  ||||||||| |||||| ||||| || c
3'   ggugggg  uauugucgu ggggug accuu au a
   gg       uc         c      -     g  c 
Get sequence
Deep sequencing
49 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 6416779-6416854 [+]
sense
ENSSSCT00000021501 ; ssc-mir-194a.1-201; exon 1
Clustered miRNAs
< 10kb from ssc-mir-194a
ssc-mir-194achr2: 6416779-6416854 [+]
ssc-mir-192chr2: 6416980-6417059 [+]
Database links

Mature sequence ssc-miR-194a-5p

Accession MIMAT0025368
Sequence

11 - 

uguaacagcaacuccaugugg

 - 31

Get sequence
Deep sequencing49 reads, 11 experiments
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-194a-3p

Accession MIMAT0037465
Sequence

47 - 

ccaguggggcugcuguuaucu

 - 67

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).