Stem-loop sequence ssc-mir-182

AccessionMI0022135 (change log)
DescriptionSus scrofa miR-182 stem-loop
Gene family MIPF0000116; mir-182
Literature search

9 open access papers mention ssc-mir-182
(18 sentences)

Stem-loop
   -         uu       u -g      uca      ugagau 
5'  ucgcaccgu  uuggcaa g  uagaac   cacugg      a
    |||||||||  ||||||| |  ||||||   ||||||       
3'  agcguggua  aaccguu c  aucuug   guggcc      a
   g         uc       - ag      ---      uagggu 
Get sequence
Deep sequencing
1638 reads, 40 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr18: 20035212-20035295 [+]
sense
ENSSSCT00000020334 ; ssc-mir-182.1-201; exon 1
Clustered miRNAs
< 10kb from ssc-mir-182
ssc-mir-183chr18: 20030651-20030720 [+]
ssc-mir-96chr18: 20030888-20030972 [+]
ssc-mir-182chr18: 20035212-20035295 [+]
Database links

Mature sequence ssc-miR-182

Accession MIMAT0025366
Sequence

11 - 

uuuggcaaugguagaacucacacu

 - 34

Get sequence
Deep sequencing1635 reads, 15 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).