Stem-loop sequence ssc-mir-137

AccessionMI0022130 (change log)
DescriptionSus scrofa miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

4 open access papers mention ssc-mir-137
(5 sentences)

Stem-loop
   a          ug   g           ug a     -  g 
5'  cucucuucgg  acg guauucuuggg  g uaaua cg a
    ||||||||||  ||| |||||||||||  | ||||| || u
3'  gagaggagcu  ugc cauaagaauuc  u auugu gc u
   -          ga   g           gu -     u  a 
Get sequence
Deep sequencing
339 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr4: 131567078-131567159 [-]
sense
ENSSSCT00000020633 ; ssc-mir-137.1-201; exon 1
Database links

Mature sequence ssc-miR-137

Accession MIMAT0025362
Sequence

50 - 

uuauugcuuaagaauacgcguag

 - 72

Get sequence
Deep sequencing339 reads, 15 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).