Stem-loop sequence ssc-mir-31

AccessionMI0022127 (change log)
DescriptionSus scrofa miR-31 stem-loop
Gene family MIPF0000064; mir-31
Literature search

10 open access papers mention ssc-mir-31
(32 sentences)

Stem-loop
   -  u      ga     g   c         -u   aaa 
5'  ac ggagag  ggcaa aug uggcauagc  guu   c
    || ||||||  ||||| ||| |||||||||  |||    
3'  ug ucuuuc  ccguu uac accguaucg  caa   u
   c  u      ua     a   a         uc   gag 
Get sequence
Deep sequencing
460 reads, 41.7 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 224397161-224397238 [+]
antisense
ENSSSCT00000019770 ; ssc-mir-31.1-201; exon 1
Database links

Mature sequence ssc-miR-31

Accession MIMAT0025360
Sequence

11 - 

aggcaagaugcuggcauagcug

 - 32

Get sequence
Deep sequencing434 reads, 12 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).