Stem-loop sequence ssc-mir-29b-2

AccessionMI0022126 (change log)
DescriptionSus scrofa miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Literature search

28 open access papers mention ssc-mir-29b-2
(65 sentences)

Stem-loop
   ---         -          c      g  u    uuuucc 
5'    cuucuggaa gcugguuuca auggug cu agau      a
      ||||||||| |||||||||| |||||| || ||||       
3'    gaggauuuu ugacuaaagu uaccac ga ucua      u
   aau         g          u      -  -    uguuuc 
Get sequence
Deep sequencing
517 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 148552438-148552521 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-29b-2
ssc-mir-29b-2chr9: 148552438-148552521 [+]
ssc-mir-29cchr9: 148552997-148553084 [+]
Database links

Mature sequence ssc-miR-29b

Accession MIMAT0002137
Sequence

52 - 

uagcaccauuugaaaucaguguu

 - 74

Get sequence
Deep sequencing1057 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).