Stem-loop sequence ssc-mir-20b-1

AccessionMI0022124 (change log)
DescriptionSus scrofa miR-20b-1 stem-loop
Gene family MIPF0000001; mir-17
Literature search

12 open access papers mention ssc-mir-20b-1
(23 sentences)

Stem-loop
   -    c     -ca           g     g   -  uuu 
5'  ccgg aguac   aagugcucaca ugcag uag gu   g
    |||| |||||   ||||||||||| ||||| ||| ||    
3'  gguu ucaug   uucacgggugu auguc auc ca   c
   a    c     acc           g     -   u  uua 
Get sequence
Deep sequencing
1251 reads, 185 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 126199775-126199854 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-20b-1
ssc-mir-106achrX: 126200183-126200263 [-]
ssc-mir-18bchrX: 126200019-126200101 [-]
ssc-mir-20b-1chrX: 126199775-126199854 [-]
ssc-mir-19b-2chrX: 126199650-126199729 [-]
ssc-mir-92a-2chrX: 126199512-126199591 [-]
ssc-mir-363-1chrX: 126199347-126199426 [-]
Database links

Mature sequence ssc-miR-20b

Accession MIMAT0025359
Sequence

11 - 

caaagugcucacagugcagguag

 - 33

Get sequence
Deep sequencing2498 reads, 13 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).