Stem-loop sequence ssc-mir-9-3

AccessionMI0022123 (change log)
DescriptionSus scrofa miR-9-3 stem-loop
Gene family MIPF0000014; mir-9
Literature search

9 open access papers mention ssc-mir-9-3
(56 sentences)

Stem-loop
   -cc       -  c               g     gu  ca 
5'    cguuucu cu uuugguuaucuagcu uauga  gc  c
      ||||||| || ||||||||||||||| |||||  ||   
3'    guaaaga ga aagccaauagaucga auacu  cg  a
   uca       u  -               a     gc  ag 
Get sequence
Deep sequencing
1230 reads, 75 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr7: 59924193-59924273 [+]
sense
ENSSSCT00000020768 ; ssc-mir-9-3.1-201; exon 1
Database links

Mature sequence ssc-miR-9

Accession MIMAT0025358
Sequence

11 - 

ucuuugguuaucuagcuguaug

 - 32

Get sequence
Deep sequencing791 reads, 11 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).