Stem-loop sequence ssc-mir-7-1

AccessionMI0022122 (change log)
DescriptionSus scrofa miR-7-1 stem-loop
Gene family MIPF0000022; mir-7
Literature search

12 open access papers mention ssc-mir-7-1
(22 sentences)

Stem-loop
   ca   ----    c   a     a u     u       ucuca 
5'   gcc    ccau ugg agacu g gauuu guuguug     c
     |||    |||| ||| ||||| | ||||| |||||||      
3'   cgg    ggua gcc ucuga c cugaa caacaac     u
   ac   ccgu    c   g     c -     -       ucgcg 
Get sequence
Deep sequencing
1919 reads, 260 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 212651386-212651469 [-]
sense
ENSSSCT00000021406 ; ssc-mir-7-1.1-201; exon 1
Database links

Mature sequence ssc-miR-7-5p

Accession MIMAT0002141
Sequence

11 - 

uggaagacuagugauuuuguuguu

 - 34

Get sequence
Deep sequencing4545 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).