Stem-loop sequence ssc-let-7d

AccessionMI0022120 (change log)
DescriptionSus scrofa let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

41 open access papers mention ssc-let-7d
(119 sentences)

Stem-loop
   --- uu       a              c      uuagggcagagauu 
5'    g  ccuagga gagguaguagguug auaguu              u
      |  ||||||| |||||||||||||| ||||||               
3'    c  ggauucu uuccgucguccagc uaucaa              u
   auu cg       -              a      uggaggaacacccg 
Get sequence
Deep sequencing
3854 reads, 653 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr3: 44867267-44867362 [+]
sense
ENSSSCT00000020959 ; ssc-let-7d.1-201; exon 1
Clustered miRNAs
< 10kb from ssc-let-7d
ssc-let-7a-2chr3: 44864433-44864524 [+]
ssc-let-7f-2chr3: 44864800-44864896 [+]
ssc-let-7dchr3: 44867267-44867362 [+]
Database links

Mature sequence ssc-let-7d-5p

Accession MIMAT0025356
Sequence

11 - 

agagguaguagguugcauaguu

 - 32

Get sequence
Deep sequencing3649 reads, 15 experiments
Evidence experimental; Illumina [1-2]

Mature sequence ssc-let-7d-3p

Accession MIMAT0025357
Sequence

65 - 

cuauacgaccugcugccuuucu

 - 86

Get sequence
Deep sequencing203 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).