Stem-loop sequence pde-MIR3712

AccessionMI0022119 (change log)
DescriptionPinus densata miR3712 stem-loop
Gene family MIPF0001625; MIR3712
Literature search

1 open access papers mention pde-MIR3712
(2 sentences)

Stem-loop
   ---ga     -    a  auc     cc     c a 
5'      gaugu gauc ag   agacu  caaau c a
        ||||| |||| ||   |||||  ||||| |  
3'      cuaua uuag uc   ucugg  guuua g c
   accua     a    c  guu     -a     c a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pde-miR3712

Accession MIMAT0025355
Sequence

5 - 

ugugaucaagaucagacuccca

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22480283 "Transcriptome-wide identification and characterization of miRNAs from Pinus densata" Wan LC, Zhang H, Lu S, Zhang L, Qiu Z, Zhao Y, Zeng QY, Lin J BMC Genomics. 13:132(2012).