Stem-loop sequence pde-MIR3704b

AccessionMI0022118 (change log)
DescriptionPinus densata miR3704b stem-loop
Gene family MIPF0001425; MIR3704
Literature search

1 open access papers mention pde-MIR3704b
(3 sentences)

Stem-loop
           -       ga   a        g   guua     c  ag   -  a 
5' aaggucau gggucuc  ugg guugggaa acu    cagug au  aug uc u
   |||||||| |||||||  ||| |||||||| |||    ||||| ||  ||| ||  
3' uuccggua uccagag  acc caaccuuu ugg    gucau ua  uac ag c
           g       ac   -        a   augc     -  aa   u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pde-miR3704b

Accession MIMAT0025354
Sequence

10 - 

ggucucgauggaguugggaaga

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22480283 "Transcriptome-wide identification and characterization of miRNAs from Pinus densata" Wan LC, Zhang H, Lu S, Zhang L, Qiu Z, Zhao Y, Zeng QY, Lin J BMC Genomics. 13:132(2012).