Stem-loop sequence pde-MIR1314

AccessionMI0022115 (change log)
DescriptionPinus densata miR1314 stem-loop
Gene family MIPF0001609; MIR1314
Literature search

1 open access papers mention pde-MIR1314
(1 sentences)

Stem-loop
   gucaug    u    u     a       -      a       augu    u 
5'       uugg uaga gaagg auucuuc aacauu gaggccg    ggag u
         |||| |||| ||||| ||||||| |||||| |||||||    |||| a
3'       aauc aucu cuuuu uaagagg uuguaa cuccggc    ucuc u
   ---acg    c    c     g       a      g       cagu    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pde-miR1314

Accession MIMAT0025351
Sequence

64 - 

ccggccucgaauguuaggagaa

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22480283 "Transcriptome-wide identification and characterization of miRNAs from Pinus densata" Wan LC, Zhang H, Lu S, Zhang L, Qiu Z, Zhao Y, Zeng QY, Lin J BMC Genomics. 13:132(2012).