Stem-loop sequence pde-MIR1312

AccessionMI0022113 (change log)
DescriptionPinus densata miR1312 stem-loop
Gene family MIPF0001466; MIR1312
Literature search

1 open access papers mention pde-MIR1312
(1 sentences)

Stem-loop
   -  c  c        c  a       -a       u     gguugaaucgaaacagccaacacuuuc 
5'  uc cc aaaacauc au ucgcuau  ucucucc aauua                           a
    || || |||||||| || |||||||  ||||||| |||||                           g
3'  ag gg uuuuguag ua agcggua  agagagg uuaau                           u
   u  c  c        a  c       aa       u     acgucuuuguuugauuauaaacuuagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pde-miR1312

Accession MIMAT0025349
Sequence

100 - 

uuuggagagaaaauggcgacau

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22480283 "Transcriptome-wide identification and characterization of miRNAs from Pinus densata" Wan LC, Zhang H, Lu S, Zhang L, Qiu Z, Zhao Y, Zeng QY, Lin J BMC Genomics. 13:132(2012).