Stem-loop sequence pde-MIR1311

AccessionMI0022112 (change log)
DescriptionPinus densata miR1311 stem-loop
Literature search

1 open access papers mention pde-MIR1311
(4 sentences)

Stem-loop
   --       ca      -      u     c c    a    ac 
5'   guaggaa  ggcgga cuggca aacuc g ccau uuuu  u
     |||||||  |||||| |||||| ||||| | |||| ||||   
3'   cauccuu  ccgccu gaccgu uugag c ggua gaga  g
   gu       ac      u      u     a u    -    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pde-miR1311

Accession MIMAT0025348
Sequence

54 - 

ucagaguuuugccaguuccgcc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22480283 "Transcriptome-wide identification and characterization of miRNAs from Pinus densata" Wan LC, Zhang H, Lu S, Zhang L, Qiu Z, Zhao Y, Zeng QY, Lin J BMC Genomics. 13:132(2012).