Stem-loop sequence pde-MIR952c

AccessionMI0022110 (change log)
DescriptionPinus densata miR952c stem-loop
Gene family MIPF0000426; MIR952
Literature search

1 open access papers mention pde-MIR952c
(2 sentences)

Stem-loop
   gcgagcuaucgaaggaga      gu    u       a  a a  c           u     c     g c      c    u         u   c         a cuu   c    ca     cua               g        auggacug      -           guaguccgcugguuucugccaccguugggacucuccccaaccuauucucagcugcaacauuc 
5'                   gaacca  ggcg auugaac ga c ug cauugguggag aagua gucaa g acgaaa agaa uaauuuuga uaa guuuuauua c   caa ucug  uuggc   uggcaguuccucaag ucacaucg        ggggcg ugauacaaggc                                                              a
                     ||||||  |||| ||||||| || | || ||||||||||| ||||| ||||| | |||||| |||| ||||||||| ||| ||||||||| |   ||| ||||  |||||   ||||||||||||||| ||||||||        |||||| |||||||||||                                                              c
3'                   cuuggu  ucgu uaacuug cu g ac guaaccgccuc uucau caguu u uguuuu ucuu auuaaagcu auu caaaaugau g   guu agac  aaccg   accgucaagggguuu aguguggu        ccccgc acuauguuucg                                                              a
   ------------------      ag    u       a  c c  a           c     a     g u      a    c         u   a         c uac   c    cg     uac               g        -----caa      g           accaacaacgcugcgaaacgucagaaggguaaaauaagagccuacguuguaacauuuauuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pde-miR952c

Accession MIMAT0025346
Sequence

36 - 

aacagaacaugccauuggug

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22480283 "Transcriptome-wide identification and characterization of miRNAs from Pinus densata" Wan LC, Zhang H, Lu S, Zhang L, Qiu Z, Zhao Y, Zeng QY, Lin J BMC Genomics. 13:132(2012).