Stem-loop sequence pde-MIR950

AccessionMI0022106 (change log)
DescriptionPinus densata miR950 stem-loop
Gene family MIPF0000407; MIR950
Literature search

1 open access papers mention pde-MIR950
(2 sentences)

Stem-loop
          a    ua      guc             ug --u  u 
5' gaaggug ucuu  caucug   cacggugguuuau  u   ca c
   ||||||| ||||  ||||||   |||||||||||||  |   || g
3' cuuccac agaa  guagac   gugcuaccaaaua  a   gu u
          g    ua      gcc             gu uuu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pde-miR950

Accession MIMAT0025342
Sequence

17 - 

ucugguccacggugguuuau

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22480283 "Transcriptome-wide identification and characterization of miRNAs from Pinus densata" Wan LC, Zhang H, Lu S, Zhang L, Qiu Z, Zhao Y, Zeng QY, Lin J BMC Genomics. 13:132(2012).