Stem-loop sequence pde-MIR949a

AccessionMI0022104 (change log)
DescriptionPinus densata miR949a stem-loop
Gene family MIPF0001455; MIR949
Literature search

1 open access papers mention pde-MIR949a
(1 sentences)

Stem-loop
   -c           -a      a    u        --- u    c 
5'   agagcuucucu  ggaauc aaug gucuuccu   c ugaa g
     |||||||||||  |||||| |||| ||||||||   | |||| c
3'   ucucgaagagg  ccuuag uuac cggaagga   g acuu c
   cc           gc      g    c        cac c    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pde-miR949a

Accession MIMAT0025340
Sequence

8 - 

ucucuaggaaucaaauguguc

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22480283 "Transcriptome-wide identification and characterization of miRNAs from Pinus densata" Wan LC, Zhang H, Lu S, Zhang L, Qiu Z, Zhao Y, Zeng QY, Lin J BMC Genomics. 13:132(2012).