Stem-loop sequence pde-MIR482c

AccessionMI0022099 (change log)
DescriptionPinus densata miR482c stem-loop
Gene family MIPF0000403; MIR482
Literature search

1 open access papers mention pde-MIR482c
(3 sentences)

Stem-loop
   aa     au      c    -  a         -   ---u    -   uau 
5'   ggcca  ggcuug gagg gu ggaaaagcu cag    guga uga   a
     |||||  |||||| |||| || ||||||||| |||    |||| |||    
3'   ccggu  ccgaac cucc ca ccuuuuuga guc    cacu gcu   u
   --     ac      c    u  c         c   uagu    c   cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pde-miR482c

Accession MIMAT0025335
Sequence

10 - 

ggcuugcgaggguaggaaaag

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22480283 "Transcriptome-wide identification and characterization of miRNAs from Pinus densata" Wan LC, Zhang H, Lu S, Zhang L, Qiu Z, Zhao Y, Zeng QY, Lin J BMC Genomics. 13:132(2012).