Stem-loop sequence pde-MIR482b

AccessionMI0022098 (change log)
DescriptionPinus densata miR482b stem-loop
Gene family MIPF0000403; MIR482
Literature search

1 open access papers mention pde-MIR482b
(5 sentences)

Stem-loop
   ------a      u   a  cuug             -    a       cugu         uca 
5'        ugugga gga gu    aggagugggaggg uagg gaaggcu    ggugagguu   g
          |||||| ||| ||    ||||||||||||| |||| |||||||    |||||||||    
3'        acacuu ccu cg    uccuuacccuccu aucc cuucuga    cuacucuaa   u
   caaugua      c   c  -uua             u    -       ----         uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pde-miR482b

Accession MIMAT0025334
Sequence

76 - 

ucuucccuauuccucccauucc

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22480283 "Transcriptome-wide identification and characterization of miRNAs from Pinus densata" Wan LC, Zhang H, Lu S, Zhang L, Qiu Z, Zhao Y, Zeng QY, Lin J BMC Genomics. 13:132(2012).