Stem-loop sequence pde-MIR482a

AccessionMI0022097 (change log)
DescriptionPinus densata miR482a stem-loop
Gene family MIPF0000403; MIR482
Literature search

1 open access papers mention pde-MIR482a
(4 sentences)

Stem-loop
   ugagaa u            uuu     u  g   cuug           -ca     u       cuuc 
5'       g gaagggaugugu   gugga gg agu    aggagugggag   uagga aaggcug    a
         | ||||||||||||   ||||| || |||    |||||||||||   ||||| |||||||    u
3'       c cuucccuacaca   cacuu cc uua    uccuuacccuc   auccu uucugac    a
   ----aa c            --c     -  g   ----           cuc     -       cacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pde-miR482a

Accession MIMAT0025333
Sequence

80 - 

ucuuuccuacuccucccauucc

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22480283 "Transcriptome-wide identification and characterization of miRNAs from Pinus densata" Wan LC, Zhang H, Lu S, Zhang L, Qiu Z, Zhao Y, Zeng QY, Lin J BMC Genomics. 13:132(2012).