Stem-loop sequence pde-MIR171

AccessionMI0022094 (change log)
DescriptionPinus densata miR171 stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

1 open access papers mention pde-MIR171
(6 sentences)

Stem-loop
   gaa                ua             ug   c   cacg 
5'    agaaugugauguuggc  ggcucaaucggau  uaa gcc    g
      ||||||||||||||||  |||||||||||||  ||| |||     
3'    ucuuacacuauaaccg  ccgaguuagucua  guu ugg    a
   caa                ug             gu   c   uuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pde-miR171

Accession MIMAT0025330
Sequence

66 - 

ugauugagccgugccaauauc

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22480283 "Transcriptome-wide identification and characterization of miRNAs from Pinus densata" Wan LC, Zhang H, Lu S, Zhang L, Qiu Z, Zhao Y, Zeng QY, Lin J BMC Genomics. 13:132(2012).