Stem-loop sequence ptc-MIR828b

AccessionMI0022050 (change log)
DescriptionPopulus trichocarpa miR828b stem-loop
Gene family MIPF0000544; MIR828
Literature search

3 open access papers mention ptc-MIR828b
(9 sentences)

Stem-loop
          g               a         uc  ac       ---   uuuugaacaagaacauauguuuu 
5' ccucuuu uaauguuucuugcuc aaugaguau  ca  aacagua   gcc                       u
   ||||||| ||||||||||||||| |||||||||  ||  |||||||   |||                        
3' ggagaag auuauaaagaacgag uuacucgua  gu  uugucau   ugg                       g
          -               c         ga  cu       uua   ucguuguaguauugguauguucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000351.2: 776048-776195 [+]
intergenic
Database links

Mature sequence ptc-miR828b-5p

Accession MIMAT0025280
Sequence

16 - 

ucuugcucaaaugaguauucca

 - 37

Get sequence
Evidence experimental; miRNAseq [1]

Mature sequence ptc-miR828b-3p

Accession MIMAT0025281
Sequence

121 - 

ucauucgagcaagaaauauua

 - 141

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).