Stem-loop sequence ptc-MIR828a

AccessionMI0022049 (change log)
DescriptionPopulus trichocarpa miR828a stem-loop
Gene family MIPF0000544; MIR828
Literature search

3 open access papers mention ptc-MIR828a
(9 sentences)

Stem-loop
     uc           u                 uc  ac         c  -au      agag     auuuuu   uugu 
5' uc  uuuuuaauguu cuugcucaaaugaguau  ca  agcaguagc uu   gcaaca    cauau      uac    a
   ||  ||||||||||| |||||||||||||||||  ||  ||||||||| ||   ||||||    |||||      |||     
3' ag  gaagauuauaa gaacgaguuuacucgua  gu  uugucaucg aa   cguugu    guaua      aug    u
     ua           u                 ga  cu         u  ggu      ---a     ------   ucac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 2050399-2050554 [-]
intergenic
Database links

Mature sequence ptc-miR828a

Accession MIMAT0025279
Sequence

16 - 

ucuugcucaaaugaguauucca

 - 37

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).