Stem-loop sequence ptc-MIR482c

AccessionMI0022048 (change log)
DescriptionPopulus trichocarpa miR482c stem-loop
Gene family MIPF0000403; MIR482
Literature search

7 open access papers mention ptc-MIR482c
(123 sentences)

Stem-loop
      ucc  cg        ----------   -        acu   uu        -  uc           a   -g    u      gaaag 
5' ucc   gc  uguuggaa          agg aaagggag   gcu  acuggaag cu  cgguaugggag ggc  ggaa gacucu     a
   |||   ||  ||||||||          ||| ||||||||   |||  |||||||| ||  ||||||||||| |||  |||| ||||||     a
3' agg   cg  acgaccuu          uuc uuucccuc   uga  ugaccuuu ga  gccauacccuc cug  ccuu cugaga     c
      ucu  --        aucacuucua   a        -cu   --        a  -c           -   ag    u      agauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000353.2: 13549387-13549557 [-]
intergenic
Database links

Mature sequence ptc-miR482c-5p

Accession MIMAT0025277
Sequence

53 - 

uaugggagaggcgggaaugacu

 - 74

Get sequence
Evidence experimental; miRNAseq [1]

Mature sequence ptc-miR482c-3p

Accession MIMAT0025278
Sequence

94 - 

ucuuuccgaguccucccauacc

 - 115

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).