Stem-loop sequence ptc-MIR482b

AccessionMI0022043 (change log)
DescriptionPopulus trichocarpa miR482b stem-loop
Gene family MIPF0000403; MIR482
Literature search

7 open access papers mention ptc-MIR482b
(125 sentences)

Stem-loop
        -   cc          --    agaccua        ug g         u  -    c      -------au   u 
5' gagaa gag  ggagggggag  acug       cuggaagu  u ggcaugagg gu uugg aagaaa         gga c
   ||||| |||  ||||||||||  ||||       ||||||||  | ||||||||| || |||| ||||||         ||| u
3' cucuu cuu  ccuuucccuc  ugac       gaccuuua  a ccguacucu ca aacc uucuuu         ccu u
        u   -c          cu    -------        gu a         c  u    a      aguaguauu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000341.2: 11901546-11901695 [-]
intergenic
Database links

Mature sequence ptc-miR482b-5p

Accession MIMAT0027338
Sequence

44 - 

ggcaugagguguuuggcaaga

 - 64

Get sequence
Evidence experimental; Illumina [2]

Mature sequence ptc-miR482b-3p

Accession MIMAT0025271
Sequence

93 - 

uuaccaauaccucucaugccaa

 - 114

Get sequence
Evidence experimental; miRNAseq [1], Illumina [2]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).
2