Stem-loop sequence ptc-MIR156l

AccessionMI0022040 (change log)
DescriptionPopulus trichocarpa miR156l stem-loop
Gene family MIPF0000008; MIR156
   -g    c      -u          gcuacauguaaucgagaauuag 
5'   uuga agaaga  ggagagcaca                      u
     |||| ||||||  ||||||||||                      c
3'   aauu ucuucu  ucuuuugugu                      c
   ca    -      uu          uucguguuugacgugaagaugu 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 34445840-34445933 [-]
Database links

Mature sequence ptc-miR156l

Accession MIMAT0025268

2 - 


 - 22

Get sequence
Evidence experimental; miRNAseq [1]


PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).