Stem-loop sequence ptc-MIR156l

AccessionMI0022040
DescriptionPopulus trichocarpa miR156l stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   -g    c      -u          gcuacauguaaucgagaauuag 
5'   uuga agaaga  ggagagcaca                      u
     |||| ||||||  ||||||||||                      c
3'   aauu ucuucu  ucuuuugugu                      c
   ca    -      uu          uucguguuugacgugaagaugu 
Get sequence
Deep sequencing
295 reads, 459 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI_Poptr2.0) Overlapping transcripts
scaffold_1: 34445840-34445933 [-]
intergenic
Database links

Mature sequence ptc-miR156l

Accession MIMAT0025268
Sequence

2 - 

uugacagaagauggagagcac

 - 22

Get sequence
Deep sequencing107 reads, 3 experiments
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).