Stem-loop sequence ptc-MIR6457b

AccessionMI0021980 (change log)
DescriptionPopulus trichocarpa miR6457b stem-loop
Gene family MIPF0001534; MIR6457
Stem-loop
                u ga  a                        -      u     a   u  c  g    a   u  a       a 
5' aaugagagaagag c  gc aaacuaaaagaggaaacuaaucua ucuccc gcaaa ugc gc aa caac ucg cu gaucuua a
   ||||||||||||| |  || |||||||||||||||||||||||| |||||| ||||| ||| || || |||| ||| || |||||||  
3' uuauucucuucuc g  cg uuugauuuucuccuuugauuagau agaggg cguuu acg cg uu guug agc ga cuagaau u
                c -a  g                        u      u     c   u  u  g    a   c  a       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000341.2: 24262248-24262423 [+]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR6457b
ptc-MIR6457bCM000341.2: 24262248-24262423 [+]
ptc-MIR6462dCM000341.2: 24265932-24266064 [+]
ptc-MIR6462eCM000341.2: 24266243-24266355 [+]
ptc-MIR6462bCM000341.2: 24270125-24270257 [+]
ptc-MIR6462fCM000341.2: 24270440-24270552 [+]
Database links

Mature sequence ptc-miR6457b

Accession MIMAT0025203
Sequence

151 - 

uuaguuuggcagccucuucuc

 - 171

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).