Stem-loop sequence mmu-mir-451b

AccessionMI0021960 (change log)
Symbol MGI:Mir451b
DescriptionMus musculus miR-451b stem-loop
Gene family MIPF0000148; mir-451
Literature search

123 open access papers mention mmu-mir-451b
(607 sentences)

Stem-loop
   ug      ca  a  ag                aa 
5'   ugggag  gc ag  aaccguuaccauuacu  a
     ||||||  || ||  ||||||||||||||||   
3'   acccuu  cg uc  uuggcaaugguaauga  c
   ga      ac  c  cu                cu 
Get sequence
Deep sequencing
43838 reads, 646 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 78073170-78073241 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-451b
mmu-mir-451bchr11: 78073170-78073241 [-]
mmu-mir-451achr11: 78073170-78073241 [+]
mmu-mir-144chr11: 78073005-78073070 [+]
Database links

Mature sequence mmu-miR-451b

Accession MIMAT0025178
Sequence

3 - 

ugggagcagcaagagaaccgu

 - 23

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).