Stem-loop sequence mmu-mir-378d

AccessionMI0021951 (change log)
Symbol MGI:Mir378d
DescriptionMus musculus miR-378d stem-loop
Literature search

72 open access papers mention mmu-mir-378d
(721 sentences)

Stem-loop
   a a    ----    uagc      -   --g      ga   uu   gauuu       g 
5'  g ugcu    ggga    acuggc cuu   gaguca  agg  ugu     gguggca c
    | ||||    ||||    |||||| |||   ||||||  |||  |||     |||||||  
3'  c acga    cccu    ugacug ggg   uuuagu  ucc  aua     cuaccgu u
   g c    auuu    ---u      u   auu      -g   cu   ---ac       c 
Get sequence
Deep sequencing
10948878 reads, 1.02e+04 reads per million, 107 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 126710282-126710391 [-]
intergenic
Database links

Mature sequence mmu-miR-378d

Accession MIMAT0025167
Sequence

16 - 

acuggccuuggagucagaaggu

 - 37

Get sequence
Deep sequencing10948873 reads, 107 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).