Stem-loop sequence mmu-mir-496b

AccessionMI0021942 (change log)
Symbol MGI:Mir496b
DescriptionMus musculus miR-496b stem-loop
Literature search

5 open access papers mention mmu-mir-496b
(9 sentences)

Stem-loop
   --u      c  a      ----a      c   -   --aauu          acaaaa 
5'    uggaag ag uggccg     uaauua uga aac      cugauuuugu      a
      |||||| || ||||||     |||||| ||| |||      ||||||||||      a
3'    acuuuc uu accggu     guuagu acu uug      gauuggagca      a
   ucu      c  a      acaac      -   a   guaauu          acucuu 
Get sequence
Deep sequencing
6 reads, 100 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 16314892-16315004 [-]
antisense
OTTMUST00000094729 ; Gnaq-003; intron 1
OTTMUST00000094727 ; Gnaq-001; intron 2
OTTMUST00000094728 ; Gnaq-002; intron 2
ENSMUST00000167656 ; Gnaq-003; intron 1
ENSMUST00000025541 ; Gnaq-001; intron 2
ENSMUST00000170229 ; Gnaq-002; intron 2
Database links

Mature sequence mmu-miR-496b

Accession MIMAT0025158
Sequence

90 - 

caacauggccaauuccuuucau

 - 111

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).