Stem-loop sequence mmu-mir-6402

AccessionMI0021938 (change log)
Symbol MGI:Mir6402
DescriptionMus musculus miR-6402 stem-loop
Literature search

1 open access papers mention mmu-mir-6402
(2 sentences)

Stem-loop
   ---   ---a      uauuau              ag   aaag 
5'    ggg    ugggaa      aacuguuuagaggg  guc    a
      |||    ||||||      ||||||||||||||  |||    g
3'    ccc    acccuu      uugacgagucucuc  cgg    g
   acg   aagg      ------              -g   acac 
Get sequence
Deep sequencing
566 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 91373284-91373363 [-]
sense
OTTMUST00000017820 ; Elavl2-003; intron 1
OTTMUST00000017821 ; Elavl2-004; intron 1
OTTMUST00000017822 ; Elavl2-005; intron 1
OTTMUST00000110558 ; Elavl2-014; intron 1
OTTMUST00000017825 ; Elavl2-001; intron 2
ENSMUST00000107120 ; Elavl2-003; intron 1
ENSMUST00000107109 ; Elavl2-004; intron 1
ENSMUST00000107111 ; Elavl2-005; intron 1
ENSMUST00000176469 ; Elavl2-014; intron 1
ENSMUST00000107124 ; Elavl2-201; intron 1
ENSMUST00000102799 ; Elavl2-001; intron 2
Database links

Mature sequence mmu-miR-6402

Accession MIMAT0025154
Sequence

57 - 

gagcaguuuucccaggaacccgc

 - 79

Get sequence
Deep sequencing563 reads, 48 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).