Stem-loop sequence mmu-mir-6400

AccessionMI0021936 (change log)
Symbol MGI:Mir6400
DescriptionMus musculus miR-6400 stem-loop
Stem-loop
   c        -u ug  uu    g   cuuac       -ua      a 
5'  aaugcggc  g  uc  gcag aag     gucuccu   gugagc u
    ||||||||  |  ||  |||| |||     |||||||   ||||||  
3'  uugugucg  c  gg  cguc uuc     uagaggg   cacucg g
   u        cu gu  uu    g   ----u       uuc      u 
Get sequence
Deep sequencing
3 reads, 1.43e+03 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 15942900-15942991 [-]
sense
OTTMUST00000010471 ; Decr1-001; intron 1
OTTMUST00000010472 ; Decr1-002; intron 2
ENSMUST00000029877 ; Decr1-001; intron 1
ENSMUST00000150464 ; Decr1-002; intron 2
Database links

Mature sequence mmu-miR-6400

Accession MIMAT0025152
Sequence

65 - 

uucuugcugcuuggugcucgc

 - 85

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).