Stem-loop sequence mmu-mir-21c

AccessionMI0021932 (change log)
Symbol MGI:Mir21c
DescriptionMus musculus miR-21c stem-loop
Literature search

649 open access papers mention mmu-mir-21c
(6276 sentences)

Stem-loop
   a         u u  cu     uau    -   gua   u 
5'  agucuucuu g ag  uagcu   caga cug   caa c
    ||||||||| | ||  |||||   |||| |||   ||| u
3'  ucaggggga c uc  aucga   gucu gac   guu u
   c         - -  uu     cuu    c   --a   c 
Get sequence
Deep sequencing
3033755 reads, 6.96e+03 reads per million, 103 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 128278148-128278225 [-]
intergenic
Database links

Mature sequence mmu-miR-21c

Accession MIMAT0025148
Sequence

18 - 

uagcuuaucagacugguacaa

 - 38

Get sequence
Deep sequencing3033754 reads, 105 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).