Stem-loop sequence mmu-mir-6396

AccessionMI0021931 (change log)
Symbol MGI:Mir6396
DescriptionMus musculus miR-6396 stem-loop
Stem-loop
   -a    ug         g    ag  -a       -agac   a  g        ga 
5'   cagg  acuaggggc aagg  cc  gugcuuc     cuc ga gccucucu  c
     ||||  ||||||||| ||||  ||  |||||||     ||| || ||||||||   
3'   gucc  ugauccucg uucc  gg  cauggag     ggg cu uggagggg  u
   ag    --         a    gg  ac       aggac   c  a        ga 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 122622265-122622375 [-]
sense
OTTMUST00000048864 ; Pabpn1l-001; intron 1
ENSMUST00000093059 ; Pabpn1l-001; intron 1
antisense
OTTMUST00000064647 ; AC114005.5-001; intron 1
ENSMUST00000127664 ; Gm20388-001; intron 1
Database links

Mature sequence mmu-miR-6396

Accession MIMAT0025147
Sequence

88 - 

ggggccuuagcuccuaguccugga

 - 111

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).