Stem-loop sequence mmu-mir-378c

AccessionMI0021923 (change log)
Symbol MGI:Mir378c
DescriptionMus musculus miR-378c stem-loop
Literature search

73 open access papers mention mmu-mir-378c
(704 sentences)

Stem-loop
   uaua ug  c ug  guc   -a  --c          g -   g      cc 
5'     c  ga u  ga   aga  gc   uuggguuuga g acu ggcuag  u
       |  || |  ||   |||  ||   |||||||||| | ||| ||||||  c
3'     g  cu a  cu   ucu  ug   aacccaaauu u ugg uugauu  u
   ---a gu  - gu  --a   ga  uac          g g   g      ac 
Get sequence
Deep sequencing
12226660 reads, 1.08e+04 reads per million, 107 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 46954830-46954928 [-]
antisense
OTTMUST00000057925 ; Samd4-002; intron 1
OTTMUST00000057924 ; Samd4-001; intron 2
ENSMUST00000137543 ; Samd4-002; intron 1
ENSMUST00000022386 ; Samd4-001; intron 2
ENSMUST00000100672 ; Samd4-201; intron 2
Database links

Mature sequence mmu-miR-378c

Accession MIMAT0025138
Sequence

4 - 

acuggacuuggagucagaagc

 - 24

Get sequence
Deep sequencing12226653 reads, 107 experiments
Evidence experimental; SOLiD [1]
Database links
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).