Stem-loop sequence mmu-mir-5124b

AccessionMI0021921 (change log)
Symbol MGI:Mir5124b
DescriptionMus musculus miR-5124b stem-loop
Stem-loop
   a     g         c  a aa c   u     u    c  a 
5'  aggau gcucaguga ua g  g aca acuga cuug ag a
    ||||| ||||||||| || |  | ||| ||||| |||| ||  
3'  ucuug uggguuacu au c  c ugu ugacu ggac uc g
   a     a         c  a ga -   -     u    -  a 
Get sequence
Deep sequencing
48 reads, 282 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 11282477-11282561 [+]
antisense
OTTMUST00000112217 ; RP23-255D19.1-001; intron 3
ENSMUST00000181173 ; Gm3839-001; intron 3
Database links

Mature sequence mmu-miR-5124b

Accession MIMAT0025136
Sequence

6 - 

uggcucagugacuaagaagca

 - 26

Get sequence
Deep sequencing20 reads, 14 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).