Stem-loop sequence mmu-mir-130c

AccessionMI0021917 (change log)
Symbol MGI:Mir130c
DescriptionMus musculus miR-130c stem-loop
Literature search

30 open access papers mention mmu-mir-130c
(56 sentences)

Stem-loop
   -      g      ----    aaa  uc ccu    -    gug 
5'  guuacg uuugga    ugua   ug  c   gcag guuu   u
    |||||| ||||||    ||||   ||  |   |||| ||||   g
3'  cagugu gaaccu    acgu   ac  g   uguc caga   u
   u      g      ugua    --g  cu ---    u    aac 
Get sequence
Deep sequencing
192 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 53400805-53400886 [-]
antisense
ENSMUST00000037853 ; Kdelc2-201; exon 8
Database links

Mature sequence mmu-miR-130c

Accession MIMAT0025132
Sequence

58 - 

cagugcaauguuccaaggugug

 - 79

Get sequence
Deep sequencing189 reads, 40 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).