Stem-loop sequence mmu-let-7j

AccessionMI0021908 (change log)
Symbol MGI:Mir7j
DescriptionMus musculus let-7j stem-loop
Literature search

397 open access papers mention mmu-let-7j
(1978 sentences)

Stem-loop
   a  g     u   uc    cauga       cug    -a        u  -u uu    gaau 
5'  uu gaggc auu  ugau     uaauuuc   aggu  uuaguuug gc  g  auau    c
    || ||||| |||  ||||     |||||||   ||||  |||||||| ||  |  ||||     
3'  aa uuccg uga  acua     auugagg   uccg  aauuagac cg  c  uaua    g
   c  g     -   --    aaaaa       ---    aa        u  uu cc    auaa 
Get sequence
Deep sequencing
6821714 reads, 1.65e+04 reads per million, 107 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 140028249-140028370 [+]
intergenic
Database links

Mature sequence mmu-let-7j

Accession MIMAT0025123
Sequence

33 - 

ugagguauuaguuugugcuguuau

 - 56

Get sequence
Deep sequencing6821712 reads, 107 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).