Stem-loop sequence mmu-mir-21b

AccessionMI0021906 (change log)
Symbol MGI:Mir21b
DescriptionMus musculus miR-21b stem-loop
Literature search

648 open access papers mention mmu-mir-21b
(6275 sentences)

Stem-loop
   u   -       u --uu  -auau       uuau    cu   a    -    ag 
5'  uug aggauac c    gc     ggauagu    caga  gau uuuc caua  a
    ||| ||||||| |    ||     |||||||    ||||  ||| |||| ||||  c
3'  aac uucuaug g    cg     ucuauca    gucu  cua aaag guau  a
   u   a       u uuuu  gucuu       ---u    uc   -    a    ga 
Get sequence
Deep sequencing
6610969 reads, 2.7e+04 reads per million, 104 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 29636744-29636851 [+]
sense
OTTMUST00000074401 ; Egfem1-004; intron 2
OTTMUST00000074404 ; Egfem1-007; intron 3
OTTMUST00000074398 ; Egfem1-001; intron 6
OTTMUST00000074399 ; Egfem1-002; intron 6
OTTMUST00000074400 ; Egfem1-003; intron 6
ENSMUST00000140288 ; Egfem1-004; intron 2
ENSMUST00000143483 ; Egfem1-007; intron 3
ENSMUST00000126420 ; Egfem1-002; intron 6
ENSMUST00000119598 ; Egfem1-001; intron 6
ENSMUST00000118531 ; Egfem1-003; intron 6
Database links

Mature sequence mmu-miR-21b

Accession MIMAT0025121
Sequence

25 - 

uaguuuaucagacugauauuucc

 - 47

Get sequence
Deep sequencing6610966 reads, 107 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).