Stem-loop sequence mmu-mir-6372

AccessionMI0021901 (change log)
Symbol MGI:Mir6372
DescriptionMus musculus miR-6372 stem-loop
Stem-loop
   c     a   - uu    aa  ac   ----     cuu     ---   cu       c 
5'  ucacu ccu c  ugaa  ga  ugg    ggaaa   ccagc   cuu  auccagg a
    ||||| ||| |  ||||  ||  |||    |||||   |||||   |||  |||||||  
3'  aguga gga g  auuu  cu  acc    ucuuu   ggucg   gaa  uggguuu g
   a     -   a uu    cc  --   ugua     --u     uac   uu       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 26202240-26202348 [+]
antisense
OTTMUST00000011818 ; RP23-306I3.1-004; intron 1
OTTMUST00000011820 ; RP23-306I3.1-006; intron 1
ENSMUST00000125773 ; 5730522E02Rik-004; intron 1
ENSMUST00000125987 ; 5730522E02Rik-006; intron 1
Database links

Mature sequence mmu-miR-6372

Accession MIMAT0025116
Sequence

19 - 

agaacuggggaaacuuccagccu

 - 41

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).