Stem-loop sequence mmu-mir-6367

AccessionMI0021896 (change log)
Symbol MGI:Mir6367
DescriptionMus musculus miR-6367 stem-loop
Stem-loop
   a    ag   u     ---aa     ag aa    -   a   caa   c   u 
5'  uccc  ccg guggg     guaga  c  gaac agg guu   agg agc u
    ||||  ||| |||||     |||||  |  |||| ||| |||   ||| |||  
3'  aggg  ggu caccu     uauuu  g  cuug ucc cag   ucc ucg g
   a    -g   -     ggcaa     aa ga    g   -   -ag   c   g 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 7 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 91527443-91527544 [-]
intergenic
Database links

Mature sequence mmu-miR-6367

Accession MIMAT0025111
Sequence

56 - 

ucccugagacccugguucagga

 - 77

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).