Stem-loop sequence mmu-mir-6366

AccessionMI0021895 (change log)
Symbol MGI:Mir6366
DescriptionMus musculus miR-6366 stem-loop
Stem-loop
   a       -aag        c   -g     aagau     g 
5'  cucuggc    ugggucuc ugg  gagga     gcuga c
    |||||||    |||||||| |||  |||||     ||||| c
3'  gagaccg    gcccgggg auc  cucuu     ugacu u
   g       aggg        a   ga     ---ac     a 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 18165089-18165170 [-]
intergenic
Database links

Mature sequence mmu-miR-6366

Accession MIMAT0025110
Sequence

57 - 

agcuaaggggcccggggagcca

 - 78

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).