Stem-loop sequence mmu-mir-6364

AccessionMI0021893 (change log)
Symbol MGI:Mir6364
DescriptionMus musculus miR-6364 stem-loop
Stem-loop
   -c      ---        -au      -   ag  aaga     u 
5'   uauagg   gcugggga   agcuua guc  ca    gcuug u
     ||||||   ||||||||   |||||| |||  ||    ||||| u
3'   gugucc   cgaccccu   uugagu cag  gu    cgaac c
   aa      uca        agc      a   ga  ---a     a 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 18 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 5215789-5215874 [-]
sense
OTTMUST00000069692 ; RP23-162H6.1-001; intron 5
ENSMUST00000050160 ; AU021092-001; intron 5
Database links

Mature sequence mmu-miR-6364

Accession MIMAT0025108
Sequence

64 - 

ucgauccccagcacuccuguga

 - 85

Get sequence
Deep sequencing22 reads, 11 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).