Stem-loop sequence mmu-mir-6362

AccessionMI0021891 (change log)
Symbol MGI:Mir6362
DescriptionMus musculus miR-6362 stem-loop
Literature search

1 open access papers mention mmu-mir-6362
(1 sentences)

Stem-loop
   a     -   u ug u  u    -a    g   -a   c    c   gg    g 
5'  uucau ucu u  c gg gggc  ucua gcu  guu uguu uug  cugu a
    ||||| ||| |  | || ||||  |||| |||  ||| |||| |||  |||| u
3'  aggua agg a  g cu ccug  aggu ugg  cga acaa aac  gaca g
   g     u   u gu u  u    ag    g   ga   -    c   ag    g 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 22605326-22605432 [+]
antisense
OTTMUST00000061251 ; Dgkg-001; intron 3
OTTMUST00000061252 ; Dgkg-003; intron 3
OTTMUST00000061253 ; Dgkg-004; intron 3
OTTMUST00000061254 ; Dgkg-005; intron 3
ENSMUST00000089925 ; Dgkg-001; intron 3
ENSMUST00000023578 ; Dgkg-004; intron 3
ENSMUST00000137311 ; Dgkg-003; intron 3
ENSMUST00000150553 ; Dgkg-005; intron 3
Database links

Mature sequence mmu-miR-6362

Accession MIMAT0025106
Sequence

17 - 

gugggcaucuaggcuaguucug

 - 38

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).