Stem-loop sequence mmu-mir-145b

AccessionMI0021890 (change log)
Symbol MGI:Mir145b
DescriptionMus musculus miR-145b stem-loop
Literature search

216 open access papers mention mmu-mir-145b
(1816 sentences)

Stem-loop
   c        gaagu  gu        cc    --    u 
5'  ucccuguu     ca  ccaguuuu  cagg  agac c
    ||||||||     ||  ||||||||  ||||  ||||  
3'  agggacaa     gu  gguuaaag  guuc  ucug c
   a        aaauu  --        -a    gg    a 
Get sequence
Deep sequencing
48260 reads, 669 reads per million, 87 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 69022199-69022273 [-]
intergenic
Database links

Mature sequence mmu-miR-145b

Accession MIMAT0025105
Sequence

17 - 

guccaguuuucccaggagacu

 - 37

Get sequence
Deep sequencing48257 reads, 86 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).