Stem-loop sequence mmu-mir-6361

AccessionMI0021889 (change log)
Symbol MGI:Mir6361
DescriptionMus musculus miR-6361 stem-loop
Stem-loop
   --a       c   aua         g   -     c    ac   -  c  ua 
5'    caugggg uga   cuguugggu agg agcuc ucug  aag gg ug  c
      ||||||| |||   ||||||||| ||| ||||| ||||  ||| || ||  u
3'    guguccc acu   gacgacucg ucc ucgag aggu  uuc cc ac  u
   uca       -   ---         g   g     -    cc   a  -  cc 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 32880573-32880673 [-]
intergenic
Database links

Mature sequence mmu-miR-6361

Accession MIMAT0025104
Sequence

78 - 

uggcucagcagucacccugugac

 - 100

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).