Stem-loop sequence mmu-mir-6354

AccessionMI0021882 (change log)
Symbol MGI:Mir6354
DescriptionMus musculus miR-6354 stem-loop
Stem-loop
   u   u          ---a     ucu     gc     ggauca       -gu      a 
5'  cuc ugcagagccc    gagua   gacuu  ccugg      ggucucu   cuuugg g
    ||| ||||||||||    |||||   |||||  |||||      |||||||   ||||||  
3'  ggg guguuuuggg    uucau   cugaa  ggacc      ucagaga   gggacc c
   u   u          guug     --u     --     --aacg       guu      u 
Get sequence
Deep sequencing
33 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 169018974-169019089 [-]
intergenic
Database links

Mature sequence mmu-miR-6354

Accession MIMAT0025097
Sequence

29 - 

ugcccuggggaucaggucucu

 - 49

Get sequence
Deep sequencing12 reads, 8 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).