Stem-loop sequence mmu-mir-6353

AccessionMI0021881 (change log)
Symbol MGI:Mir6353
DescriptionMus musculus miR-6353 stem-loop
Stem-loop
   g       cuag   g   -         ----a  -  auua        g    ga  g 
5'  ucuagac    uua cag cacguauuu     uc cu    aggguagg auua  au a
    |||||||    ||| ||| |||||||||     || ||    |||||||| ||||  ||  
3'  agguuug    gau guc gugugugag     ag ga    ucccauuu uaau  ua a
   g       --aa   g   u         gaccg  a  --gg        g    -g  a 
Get sequence
Deep sequencing
176 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 84218849-84218961 [-]
sense
OTTMUST00000104053 ; Pid1-001; intron 1
OTTMUST00000104054 ; Pid1-004; intron 1
OTTMUST00000104056 ; Pid1-005; intron 1
OTTMUST00000104057 ; Pid1-006; intron 1
OTTMUST00000104059 ; Pid1-002; intron 1
OTTMUST00000104058 ; Pid1-003; intron 2
ENSMUST00000168574 ; Pid1-001; intron 1
ENSMUST00000176559 ; Pid1-004; intron 1
ENSMUST00000176720 ; Pid1-005; intron 1
ENSMUST00000175996 ; Pid1-006; intron 1
ENSMUST00000177458 ; Pid1-002; intron 1
ENSMUST00000176822 ; Pid1-003; intron 2
Database links

Mature sequence mmu-miR-6353

Accession MIMAT0025096
Sequence

14 - 

uagcagcacguauuuauccuauu

 - 36

Get sequence
Deep sequencing157 reads, 54 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).